ROUGE

Gene/Protein Characteristic Table for mKIAA0353

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172937
Description :	desmuslin isoform H.
Clone Name :	meh00359 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 4480 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 599 bp

Genome contig ID gi65511124r_61517432
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TATCAGAGATTTAAAATTATTTTTCAAATGGAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTGCTTCTATGTACAGAAGTTTAGAAGAAAAAAAAAAAGAGGGCTTAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0353 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0353	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3881
Length: 1292 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL07180	100.0	desmuslin, isof...	Mus musculus
AAI67233	99.9	Synemin, interm...	synthetic construct
CAE30277	98.8	synemin isoform...	Mus musculus
EDM08465	85.6	rCG24674, isofo...	Rattus norvegicus
EDM08464	85.6	rCG24674, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR001664 39 47 PS00226 Intermediate filament protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001664	39	47	PS00226	Intermediate filament protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	599 bp
Genome contig ID	gi65511124r_61517432
PolyA signal sequence (None)	+--------+--------+----*----+---- TATCAGAGATTTAAAATTATTTTTCAAATGGAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTGCTTCTATGTACAGAAGTTTAGAAGAAAAAAAAAAAGAGGGCTTAG

Gene/Protein Characteristic Table for mKIAA0353

Features of the cloned DNA sequence

Features of the protein sequence