ROUGE

Gene/Protein Characteristic Table for mKIAA0347

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122253
Description :	Period circadian protein 2.
Clone Name :	mbg06119 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5800 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1887 bp

Genome contig ID gi65488608r_91139027
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AAATTGTTAAATAAAGCAAGTATATTTTTATTTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTGTATGCTTTGTTTGATGTGATGGTGGGGATTTAACCCAGGACCTCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0347 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0347	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 110..3913
Length: 1267 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL40029	99.9	period homolog ...	Mus musculus
AAC53592	99.8	PERIOD 2 [Mus m...	Mus musculus
BAE38253	99.8	unnamed protein...	Mus musculus
O54943	99.7	Period circadia...	Mus musculus
Q9Z301	95.5	Period circadia...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172958	5.1e-51	45.1	mKIAA0482
AK173261	3.9e-08	32.5	mKIAA1779

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR000014 189 256 SM00091 PAS

IPR000014 329 395 SM00091 PAS

ProfileScan IPR000014 354 397 PS50112 PAS

IPR000694 841 971 PS50099 Proline-rich region

NULL 1071 1121 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR000014	189	256	SM00091	PAS
IPR000014	329	395	SM00091	PAS
ProfileScan	IPR000014	354	397	PS50112	PAS
IPR000694	841	971	PS50099	Proline-rich region
NULL	1071	1121	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1887 bp
Genome contig ID	gi65488608r_91139027
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AAATTGTTAAATAAAGCAAGTATATTTTTATTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGTATGCTTTGTTTGATGTGATGGTGGGGATTTAACCCAGGACCTCA

Gene/Protein Characteristic Table for mKIAA0347

Features of the cloned DNA sequence

Features of the protein sequence