ROUGE

Gene/Protein Characteristic Table for mKIAA0340

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220335
Description :	Regulating synaptic membrane exocytosis protein 1 (Fragment).
Clone Name :	mbg15521 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5525 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2571 bp

Genome contig ID gi65488608r_22416597
PolyA signal sequence
(TATAAA,-14)
+----*----+----*----+----*----+----
TTCAAAGCTGCATGCATTTTGTATAAAAAAATATG
Flanking genome sequence
(99989 - 99940)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAAAGAAAAAAAGCAAAGAGACAAAAGGTTATTTAATAATGTATG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0340 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0340	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2951
Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL14395	0	92.7	regulating syna...	Mus musculus
Q9JIR4	0	85.6	Regulating syna...	Rattus norvegicus
AAB66703	0	90.7	rab3 effector [...	Rattus norvegicus
XP_613769	2e-194	71.5	similar to Regu...	Bos taurus
AAY96657	4.3e-191	88.3	regulating syna...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129206	1.3e-62	57.1	mKIAA0751

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 586 598 PR00360 C2

IPR000008 615 628 PR00360 C2

IPR000008 640 648 PR00360 C2

HMMPfam IPR001478 417 500 PF00595 PDZ/DHR/GLGF

IPR000008 571 662 PF00168 C2

HMMSmart IPR001478 426 505 SM00228 PDZ/DHR/GLGF

IPR000008 570 677 SM00239 C2

ProfileScan IPR000694 243 282 PS50099 Proline-rich region

IPR001478 417 503 PS50106 PDZ/DHR/GLGF

IPR000008 567 662 PS50004 C2

NULL 920 962 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	586	598	PR00360	C2
IPR000008	615	628	PR00360	C2
IPR000008	640	648	PR00360	C2
HMMPfam	IPR001478	417	500	PF00595	PDZ/DHR/GLGF
IPR000008	571	662	PF00168	C2
HMMSmart	IPR001478	426	505	SM00228	PDZ/DHR/GLGF
IPR000008	570	677	SM00239	C2
ProfileScan	IPR000694	243	282	PS50099	Proline-rich region
IPR001478	417	503	PS50106	PDZ/DHR/GLGF
IPR000008	567	662	PS50004	C2
NULL	920	962	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2571 bp
Genome contig ID	gi65488608r_22416597
PolyA signal sequence (TATAAA,-14)	+--------+--------+----*----+---- TTCAAAGCTGCATGCATTTTGTATAAAAAAATATG
Flanking genome sequence (99989 - 99940)	----+--------+--------+--------+--------+----* AAAAAGAAAGAAAAAAAGCAAAGAGACAAAAGGTTATTTAATAATGTATG

Gene/Protein Characteristic Table for mKIAA0340

Features of the cloned DNA sequence

Features of the protein sequence