ROUGE

Gene/Protein Characteristic Table for mKIAA0333

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129117
Description :
Clone Name :	mbg16015 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4906 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1077 bp

Genome contig ID gi66880554r_180285247
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAGTATGTTCTGTGAAGCCATAATCGGGATATAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAAAAAAAAGCAGCCACTATCTGGGTGGCAGAAGGTGCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0333 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0333	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 224..3829
Length: 1201 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM27686	100.0	death inducer-o...	Mus musculus
AAR84049	99.8	death inducer-o...	Mus musculus
Q8C9B9	100.0	Death-inducer o...	Mus musculus
AAR84050	99.8	death inducer-o...	Mus musculus
XP_001491643	79.4	similar to Deat...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122230	2.5e-16	40.3	mKIAA0244

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 285 337 PF00628 Zinc finger

IPR003618 685 799 PF07500 Transcription elongation factor S-II

IPR012921 1070 1176 PF07744 SPOC

HMMSmart IPR001965 285 335 SM00249 Zinc finger

IPR003618 687 788 SM00510 Transcription elongation factor S-II

ProfileScan IPR001965 283 337 PS50016 Zinc finger

ScanRegExp IPR001965 286 334 PS01359 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	285	337	PF00628	Zinc finger
IPR003618	685	799	PF07500	Transcription elongation factor S-II
IPR012921	1070	1176	PF07744	SPOC
HMMSmart	IPR001965	285	335	SM00249	Zinc finger
IPR003618	687	788	SM00510	Transcription elongation factor S-II
ProfileScan	IPR001965	283	337	PS50016	Zinc finger
ScanRegExp	IPR001965	286	334	PS01359	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1077 bp
Genome contig ID	gi66880554r_180285247
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAGTATGTTCTGTGAAGCCATAATCGGGATATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGAAAAAAAAAAAAGCAGCCACTATCTGGGTGGCAGAAGGTGCCC

Gene/Protein Characteristic Table for mKIAA0333

Features of the cloned DNA sequence

Features of the protein sequence