ROUGE

Gene/Protein Characteristic Table for mKIAA0311

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129115
Description :
Clone Name :	mbg19192 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5712 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3235 bp

Genome contig ID gi65532617f_49794492
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TAAATTTCAATAAATAAACAAATAAACAAGTGAAT
Flanking genome sequence
(110755 - 110804)
----+----*----+----*----+----*----+----*----+----*
AAAATAAGAATCCATGACTTCCTTCTGTGGTCCAGGCTAGTGCTGGAGTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0311 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0311	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2477
Length: 824 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
ABB60212	99.9	A-kinase anchor...	Mus musculus
EDL36760	99.9	mCG14970 [Mus m...	Mus musculus
NP_932779	99.9	A kinase (PRKA)...	Mus musculus
ABB60211	99.9	A-kinase anchor...	Mus musculus
BAE27869	99.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 73 214 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	73	214	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3235 bp
Genome contig ID	gi65532617f_49794492
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TAAATTTCAATAAATAAACAAATAAACAAGTGAAT
Flanking genome sequence (110755 - 110804)	----+--------+--------+--------+--------+----* AAAATAAGAATCCATGACTTCCTTCTGTGGTCCAGGCTAGTGCTGGAGTC

Gene/Protein Characteristic Table for mKIAA0311

Features of the cloned DNA sequence

Features of the protein sequence