ROUGE

Gene/Protein Characteristic Table for mKIAA0299

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172930
Description :	Dedicator of cytokinesis protein 3.
Clone Name :	mbg15779 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5441 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4331 bp

Genome contig ID gi65519420r_107016898
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGCTAGAACATGCATTTCTCTTCCCTAAGTAGTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATCTGCCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0299 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0299	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 109..1110
Length: 333 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL21172	1.7e-90	100.0	mCG123323 [Mus ...	Mus musculus
AAI67231	1.9e-90	100.0	Dedicator of cy...	synthetic construct
EDL77265	2.7e-90	99.6	dedicator of cy...	Rattus norvegicus
Q8CIQ7	5.6e-90	99.6	Dedicator of cy...	Mus musculus
Q8IZD9	2.2e-89	98.4	Dedicator of cy...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122353	6.6e-39	50.3	mKIAA0716

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 93 146 PD000066 SH3

FPrintScan IPR001452 107 122 PR00452 SH3

IPR001452 137 149 PR00452 SH3

HMMPfam IPR001452 93 149 PF00018 SH3

IPR011511 94 148 PF07653 Variant SH3

HMMSmart IPR001452 93 150 SM00326 SH3

ProfileScan IPR001452 90 151 PS50002 SH3

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	93	146	PD000066	SH3
FPrintScan	IPR001452	107	122	PR00452	SH3
IPR001452	137	149	PR00452	SH3
HMMPfam	IPR001452	93	149	PF00018	SH3
IPR011511	94	148	PF07653	Variant SH3
HMMSmart	IPR001452	93	150	SM00326	SH3
ProfileScan	IPR001452	90	151	PS50002	SH3

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4331 bp
Genome contig ID	gi65519420r_107016898
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCTAGAACATGCATTTCTCTTCCCTAAGTAGTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATCTGCCAG

Gene/Protein Characteristic Table for mKIAA0299

Features of the cloned DNA sequence

Features of the protein sequence