ROUGE

Gene/Protein Characteristic Table for mKIAA0290

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172927
Description :
Clone Name :	mth02050 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 4614 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3715 bp

Genome contig ID gi65515060r_70758712
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GCCTTTAGTATTCTTTAAATAAACAGTTTTCTAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATAAAGAGGAATCCTCTTTCCGGTTCAGACCGGGAAGGATGGGGAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0290 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0290	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..881, 2943..3206, 3431..3568, 3788..4045
Length: 512 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8K285	6.3e-109	62.0	FCH domain only...	Mus musculus
EDL28960	2.8e-107	60.7	FCH domain only...	Mus musculus
O14526	3e-100	55.2	FCH domain only...	Homo sapiens
AAH28021	3e-100	55.2	FCHO1 protein [...	Homo sapiens
XP_533878	3.1e-99	54.2	similar to FCH ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172943	2.7e-12	30.0	mKIAA0394

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001060 2 87 SM00055 Cdc15/Fes/CIP4

ProfileScan IPR001060 1 78 PS50133 Cdc15/Fes/CIP4

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001060	2	87	SM00055	Cdc15/Fes/CIP4
ProfileScan	IPR001060	1	78	PS50133	Cdc15/Fes/CIP4

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3715 bp
Genome contig ID	gi65515060r_70758712
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GCCTTTAGTATTCTTTAAATAAACAGTTTTCTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATAAAGAGGAATCCTCTTTCCGGTTCAGACCGGGAAGGATGGGGAGG

Gene/Protein Characteristic Table for mKIAA0290

Features of the cloned DNA sequence

Features of the protein sequence