ROUGE |
Gene/Protein Characteristic Table for mKIAA0287 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122238 |
---|---|
paternally expressed 3. paternally expressed gene 3. |
|
mbg03130 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5890 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2036 bp Genome contig ID gi65511124r_5810120 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CCTACATTTATATACCCTTCCAGTGGTTTTCTTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAATGTTACATTTGAGGTGTTCTTTAAGGTTTGGGTTTTTG
KIAA Alignment based on: KIAA0287 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 198..3851, 3855..5057
Length: 1618 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |