ROUGE

Gene/Protein Characteristic Table for mKIAA0276

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC060213
Description :
Clone Name :	mid33058 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 4087 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3101 bp

Genome contig ID gi65498774f_72181001
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
CCCATAAATAAACAGATATTTGTGTTTGGTTTCAG
Flanking genome sequence
(169729 - 169778)
----+----*----+----*----+----*----+----*----+----*
AACTGATTTGTGGGGTCTTTGTACTCTGGGTTTCTCTGCCAAAACCATTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0276 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0276	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 288..986
Length: 232 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL89953	7.5e-98	94.4	DCN1, defective...	Rattus norvegicus
Q8CCA0	7.5e-98	94.4	DCN1-like prote...	Mus musculus
BAC36553	7.8e-98	94.4	unnamed protein...	Mus musculus
BAG57987	7.9e-96	91.3	unnamed protein...	Homo sapiens
Q92564	9.4e-96	91.3	DCN1-like prote...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005176 113 227 PF03556 Protein of unknown function DUF298

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005176	113	227	PF03556	Protein of unknown function DUF298

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3101 bp
Genome contig ID	gi65498774f_72181001
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- CCCATAAATAAACAGATATTTGTGTTTGGTTTCAG
Flanking genome sequence (169729 - 169778)	----+--------+--------+--------+--------+----* AACTGATTTGTGGGGTCTTTGTACTCTGGGTTTCTCTGCCAAAACCATTT

Gene/Protein Characteristic Table for mKIAA0276

Features of the cloned DNA sequence

Features of the protein sequence