ROUGE |
Gene/Protein Characteristic Table for mKIAA0267 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122232 |
---|---|
solute carrier family 9 (sodium/hydrogen exchanger), isoform 6. | |
mbh01806 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3969 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1864 bp Genome contig ID gi66880665f_51264579 PolyA signal sequence
(TATAAA,-26) +----*----+----*----+----*----+----
GAAAATGGCTATAAATACTTAGCATGACAAATTATFlanking genome sequence
(153449 - 153498) ----+----*----+----*----+----*----+----*----+----*
ATGTAACCTGTCTCTTTTTAGCATGCATAAGATTTCTCATTAAGGAAACT
KIAA Alignment based on: KIAA0267 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2105
Length: 700 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |