Gene/Protein Characteristic Table for mKIAA0265

Length: 1461 bp

Restriction map

Length of 3'UTR	143 bp
Genome contig ID	gi65504368f_30349003
PolyA signal sequence (AATACA,-23)	+----*----+----*----+----*----+---- CCTTATTCAGAAAATACATCAGATGCCTTTTTGTG
Flanking genome sequence (148366 - 148415)	----+----*----+----*----+----*----+----*----+----* AATGGGTTTAGTTTATGGACATTTCACTTTCTCATGTGCTTTCTTCTTTG

KIAA	Alignment based on:
KIAA0265	DNA sequence, AA sequence, Physical map

Coding region: 80..1318

Length: 412 aa

Entry Exp ID% Protein Source Q5U3Y0 1.7e-167 100.0 Kelch domain-co... Rattus norvegicus XP_001094651 9.4e-162 96.4 similar to scru... Macaca mulatta BAC39372 1.2e-145 93.2 unnamed protein... Mus musculus Q6PAR0 1.2e-145 93.4 Kelch domain-co... Mus musculus BAB27179 3.1e-145 99.4 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122377 0.00064 25.0 mKIAA0817

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011498	61	118	PF07646	Kelch
	IPR006652	61	118	PF01344	Kelch repeat
	IPR011498	123	171	PF07646	Kelch
	IPR006652	123	171	PF01344	Kelch repeat
	IPR011498	176	221	PF07646	Kelch
	IPR006652	176	221	PF01344	Kelch repeat
	IPR011498	229	276	PF07646	Kelch
	IPR006652	229	276	PF01344	Kelch repeat
	IPR011498	285	330	PF07646	Kelch
	IPR006652	285	330	PF01344	Kelch repeat

Method	From	To	amino acid sequence
-	-	-	-