ROUGE |
Gene/Protein Characteristic Table for mKIAA0263 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172921 |
---|---|
inositol hexaphosphate kinase 1. inositol hexakisphosphate kinase 6. |
|
mfj32020 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4469 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2808 bp Genome contig ID gi65519420f_107970577 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
GGTCGTATACGTCAAAATAAAGCCTCTAGAAACTGFlanking genome sequence
(146193 - 146242) ----+----*----+----*----+----*----+----*----+----*
AACTCTGTCCAAGTCTGTGTGAAAACTTCATCGCCTCCGGTTGGGCCGAC
KIAA Alignment based on: KIAA0263 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 297..1661
Length: 454 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |