ROUGE |
Gene/Protein Characteristic Table for mKIAA0251 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK004611 |
---|---|
mid06092 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2829 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 663 bp Genome contig ID gi65546577r_12470149 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGTCTCACAAAAGGAATAAAAGAAAGGTCTGGGTCFlanking genome sequence
(99873 - 99824) ----+----*----+----*----+----*----+----*----+----*
TTTTGCTTTTGTTGCTGTTTGTCTGTCTTGTTTTTGAGACAGGGACTGAC
KIAA Alignment based on: KIAA0251 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..2166
Length: 721 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |