ROUGE |
Gene/Protein Characteristic Table for mKIAA0245 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129099 |
---|---|
solute carriersolute carrier family 7 (cationic amino acid transporter, y+ system), member 6. | |
mpm02214 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4289 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1229 bp Genome contig ID gi65515060f_105386026 PolyA signal sequence
(AATAAA,-31) +----*----+----*----+----*----+----
ATAAAATAAATCTTTGGATTTTTGGTATGAACTGCFlanking genome sequence
(107845 - 107894) ----+----*----+----*----+----*----+----*----+----*
AAGAGGCCTGGAATGTTCTACATAAGGTGTTATGCAAAATTCAGGTAGAT
KIAA Alignment based on: KIAA0245 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2002..3060
Length: 352 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |