ROUGE

Gene/Protein Characteristic Table for mKIAA0227

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172918
Description :
Clone Name :	mfj01453 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4744 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3928 bp

Genome contig ID gi65532617f_78391575
PolyA signal sequence
(CATAAA,-19)
+----*----+----*----+----*----+----
GGTGCTTTTTAACATACATAAACTCCTAATTCTGC
Flanking genome sequence
(136304 - 136353)
----+----*----+----*----+----*----+----*----+----*
AACTAATTTGTTCTATGTTGCTAGCTTTTCCTGCTGGTATCCTCAACCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0227 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0227	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..816
Length: 271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH28891	5.8e-85	100.0	Ttc9 protein [M...	Mus musculus
EDL02721	1.1e-84	100.0	mCG7933, isofor...	Mus musculus
Q3V038	2.1e-70	100.0	Tetratricopepti...	Mus musculus
XP_001082201	5.9e-62	77.9	similar to Tetr...	Macaca mulatta
AAH47950	7e-62	78.3	TTC9 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 213 246 PF07719 NULL

HMMSmart IPR001440 108 141 SM00028 TPR repeat

IPR001440 177 212 SM00028 TPR repeat

IPR001440 213 246 SM00028 TPR repeat

ProfileScan IPR001440 177 246 PS50293 TPR repeat

IPR001440 213 246 PS50005 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	213	246	PF07719	NULL
HMMSmart	IPR001440	108	141	SM00028	TPR repeat
IPR001440	177	212	SM00028	TPR repeat
IPR001440	213	246	SM00028	TPR repeat
ProfileScan	IPR001440	177	246	PS50293	TPR repeat
IPR001440	213	246	PS50005	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3928 bp
Genome contig ID	gi65532617f_78391575
PolyA signal sequence (CATAAA,-19)	+--------+--------+----*----+---- GGTGCTTTTTAACATACATAAACTCCTAATTCTGC
Flanking genome sequence (136304 - 136353)	----+--------+--------+--------+--------+----* AACTAATTTGTTCTATGTTGCTAGCTTTTCCTGCTGGTATCCTCAACCCT

Gene/Protein Characteristic Table for mKIAA0227

Features of the cloned DNA sequence

Features of the protein sequence