ROUGE

Gene/Protein Characteristic Table for mKIAA0220

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220328
Description :
Clone Name :	mfj56181 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3909 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2995 bp

Genome contig ID gi65511124r_111979804
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TATACTTACATATAACAAATAAATAACTCTTTTTT
Flanking genome sequence
(99819 - 99770)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGGAAAAAAAGAAAGAAGGGTTTTTTCTTAGTAGCCCCGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0220 DNA sequence

KIAA	Alignment based on:
KIAA0220	DNA sequence

Features of the protein sequence	Description

Coding region: 3..911
Length: 303 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC33729	6.4e-101	99.6	unnamed protein...	Mus musculus
BAC33168	9.5e-101	99.6	unnamed protein...	Mus musculus
BAC30884	1.5e-100	99.6	unnamed protein...	Mus musculus
XP_001078729	3.4e-100	99.6	similar to PI-3...	Rattus norvegicus
NP_001026984	3.4e-100	99.6	PI-3-kinase-rel...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2995 bp
Genome contig ID	gi65511124r_111979804
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TATACTTACATATAACAAATAAATAACTCTTTTTT
Flanking genome sequence (99819 - 99770)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGGAAAAAAAGAAAGAAGGGTTTTTTCTTAGTAGCCCCGG

Gene/Protein Characteristic Table for mKIAA0220

Features of the cloned DNA sequence

Features of the protein sequence