Order Kazusa clone(s) from : ![]() |
Product ID | ORK05585 |
---|---|
Accession No | D86974 |
Description | Homo sapiens mRNA for KIAA0220 gene, partial cds. |
Clone name | ha04626 |
Vector information | |
cDNA sequence | DNA sequence (5471 bp) Predicted protein sequence (553 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0220
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 128 bp |
---|---|
Genome contig ID | gi51511732r_21220978 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 21320978 | 21377463 | 24 | 99.3 | Terminal No-hit |
| 16 | f | 22399084 | 22455335 | 25 | 99.1 | Terminal No-hit |
| 16 | r | 21753412 | 21809706 | 26 | 98.8 | Terminal No-hit |
| 16 | r | 29402383 | 29459387 | 25 | 98.3 | Both No-hit |
| 16 | r | 29300140 | 29357622 | 27 | 97.2 | Both No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CGGAGGTTGAGCTGAGAAGAG |
Primer_r | TGTTAGTTTTTGGAGTGTGGG |
PCR product length | 118 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |