ROUGE

Gene/Protein Characteristic Table for mKIAA0217

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172916
Description :
Clone Name :	mfj00945 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 5132 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2610 bp

Genome contig ID gi65535943f_8977515
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GTAGCTTATGAAAAATAAAGATTTAGGCACTGTTC
Flanking genome sequence
(180483 - 180532)
----+----*----+----*----+----*----+----*----+----*
AATTTTTCTTTTGATTCTTTTAAATTAAAATTTTCTTGAAGAATGCATTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0217 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0217	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 273..2522
Length: 749 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6A0A2	99.6	La-related prot...	Mus musculus
EDL32285	99.3	La ribonucleopr...	Mus musculus
EDM06963	95.9	La ribonucleopr...	Rattus norvegicus
XP_001137313	87.3	La ribonucleopr...	Pan troglodytes
Q92615	87.6	La-related prot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006630 170 227 PF05383 RNA-binding protein Lupus La

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006630	170	227	PF05383	RNA-binding protein Lupus La

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2610 bp
Genome contig ID	gi65535943f_8977515
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTAGCTTATGAAAAATAAAGATTTAGGCACTGTTC
Flanking genome sequence (180483 - 180532)	----+--------+--------+--------+--------+----* AATTTTTCTTTTGATTCTTTTAAATTAAAATTTTCTTGAAGAATGCATTT

Gene/Protein Characteristic Table for mKIAA0217

Features of the cloned DNA sequence

Features of the protein sequence