ROUGE

Gene/Protein Characteristic Table for mKIAA0200

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129088
Description :	mastermind like 1.
Clone Name :	mpf00402 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5518 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2212 bp

Genome contig ID gi65527427r_49908479
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GTTATAAAAATAATAAAAATATTTTACTAGTATGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATCACAAGCATGTTTGACTTCAGTGGGACATTTGACAGCTGTCAATTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0200 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0200	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 169..3306
Length: 1045 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6T264	99.6	Mastermind-like...	Mus musculus
EDL33707	99.5	mastermind like...	Mus musculus
AAS07633	99.6	mastermind-like...	Mus musculus
XP_001105097	86.0	mastermind-like...	Macaca mulatta
XP_527150	86.1	mastermind-like...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173269	8.4e-07	31.0	mKIAA1816
AK129448	1.5e-06	26.9	mKIAA1819

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 95 131 PS50310 NULL

NULL 650 717 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	95	131	PS50310	NULL
NULL	650	717	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2212 bp
Genome contig ID	gi65527427r_49908479
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTTATAAAAATAATAAAAATATTTTACTAGTATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCACAAGCATGTTTGACTTCAGTGGGACATTTGACAGCTGTCAATTT

Gene/Protein Characteristic Table for mKIAA0200

Features of the cloned DNA sequence

Features of the protein sequence