ROUGE

Gene/Protein Characteristic Table for mKIAA0189

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172910
Description :	StAR-related lipid transfer protein 8 (Fragment).
Clone Name :	msj09108 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2379 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1522 bp

Genome contig ID gi66880665f_93571580
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CCCTCTGCAGAATAATAAAGCAGGACTGGAGATGC
Flanking genome sequence
(104511 - 104560)
----+----*----+----*----+----*----+----*----+----*
ACACTGGCTCTGGAGAGTTTGTTTTGCTGAGACAATGGGCTGGGAGCTTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0189 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0189	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..857
Length: 284 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH23434	2.5e-121	100.0	Stard8 protein ...	Mus musculus
AAH34186	5.2e-121	100.0	Stard8 protein ...	Mus musculus
Q8K031	6e-121	100.0	StAR-related li...	Mus musculus
BAE21930	6e-121	100.0	unnamed protein...	Mus musculus
NP_001101319	9.5e-121	99.6	StAR-related li...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002913 79 281 PF01852 Lipid-binding START

HMMSmart IPR002913 79 281 SM00234 Lipid-binding START

ProfileScan IPR002913 83 253 PS50848 Lipid-binding START

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002913	79	281	PF01852	Lipid-binding START
HMMSmart	IPR002913	79	281	SM00234	Lipid-binding START
ProfileScan	IPR002913	83	253	PS50848	Lipid-binding START

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1522 bp
Genome contig ID	gi66880665f_93571580
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCCTCTGCAGAATAATAAAGCAGGACTGGAGATGC
Flanking genome sequence (104511 - 104560)	----+--------+--------+--------+--------+----* ACACTGGCTCTGGAGAGTTTGTTTTGCTGAGACAATGGGCTGGGAGCTTG

Gene/Protein Characteristic Table for mKIAA0189

Features of the cloned DNA sequence

Features of the protein sequence