ROUGE

Gene/Protein Characteristic Table for mKIAA0180

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220326
Description :	GDP-fucose protein O-fucosyltransferase 1 precursor.
Clone Name :	mfj16320 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4854 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2192 bp

Genome contig ID gi66880554f_152614688
PolyA signal sequence
(AATAGA,-21)
+----*----+----*----+----*----+----
TGTGAACATAGCTGAATAGATGCTTTTAATTATGT
Flanking genome sequence
(110314 - 110363)
----+----*----+----*----+----*----+----*----+----*
AAGCTTCCACTGAGGAGTGTTTCATAGTTTGTGACTCACCTTCTATGAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0180 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0180	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1718..2662
Length: 314 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001034144	4.4e-132	99.7	protein O-fucos...	Mus musculus
Q91ZW2	3.5e-89	100.0	GDP-fucose prot...	Mus musculus
BAC32009	6.7e-89	99.5	unnamed protein...	Mus musculus
Q6EV70	2.2e-85	94.8	GDP-fucose prot...	Rattus norvegicus
Q9H488	7.6e-81	89.9	GDP-fucose prot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2192 bp
Genome contig ID	gi66880554f_152614688
PolyA signal sequence (AATAGA,-21)	+--------+--------+----*----+---- TGTGAACATAGCTGAATAGATGCTTTTAATTATGT
Flanking genome sequence (110314 - 110363)	----+--------+--------+--------+--------+----* AAGCTTCCACTGAGGAGTGTTTCATAGTTTGTGACTCACCTTCTATGAGA

Gene/Protein Characteristic Table for mKIAA0180

Features of the cloned DNA sequence

Features of the protein sequence