Order Kazusa clone(s) from : ![]() |
Product ID | ORK00446 |
---|---|
Accession No | D80002 |
Description | protein O-fucosyltransferase 1, transcript variant 1 |
Clone name | ha02567s1 |
Vector information | |
cDNA sequence | DNA sequence (5189 bp) Predicted protein sequence (403 aa) |
HaloTag ORF Clone |
FHC00446
![]() |
Flexi ORF Clone | FXC00446 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0180
by Kazusa Mouse cDNA Project
|
Note | We replaced ha02567, former representative clones for KIAA0180 with ha02567s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3976 bp |
---|---|
Genome contig ID | gi51511747f_30159360 |
PolyA signal sequence (AATAAA,-9) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (130743 - 130792) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 30259360 | 30290101 | 7 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 19 | AAWARPLSVSFLLLLLPLPGMP | 40 | PRIMARY | 22 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | AAGGAGGTGGGAAATGATTAG |
Primer_r | AACAGGGAAAACATGATACAC |
PCR product length | 150 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |