ROUGE

Gene/Protein Characteristic Table for mKIAA0174

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122215
Description :
Clone Name :	mbg01769 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6806 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 6135 bp

Genome contig ID gi65515060r_108869005
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AGCTCTAGCTGCTAATAAAGATCCCATGTCCTGCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTCTCTAGTGTTGGTCAAATGAGTGAATTTGGATTTTAGTGGACAATAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0174 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0174	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..671
Length: 222 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH39052	2.2e-79	100.0	2400003C14Rik p...	Mus musculus
EDL11429	2.4e-79	100.0	RIKEN cDNA 2400...	Mus musculus
EDL11428	2.6e-79	100.0	RIKEN cDNA 2400...	Mus musculus
BAF84077	9.5e-77	97.2	unnamed protein...	Homo sapiens
BAF85729	3.9e-76	96.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005061 1 105 PF03398 Protein of unknown function DUF292

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005061	1	105	PF03398	Protein of unknown function DUF292

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	6135 bp
Genome contig ID	gi65515060r_108869005
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AGCTCTAGCTGCTAATAAAGATCCCATGTCCTGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTCTCTAGTGTTGGTCAAATGAGTGAATTTGGATTTTAGTGGACAATAGT

Gene/Protein Characteristic Table for mKIAA0174

Features of the cloned DNA sequence

Features of the protein sequence