KIAA0174

Product ID	ORK00445
Accession No	D79996
Description	increased sodium tolerance 1 homolog (yeast), transcript variant 1
Clone name	ha02422
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2348 bp) Predicted protein sequence (369 aa)
HaloTag ORF Clone	FHC00445
Flexi ORF Clone	FXC00445
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0174 by Kazusa Mouse cDNA Project

Length: 2348 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1190 bp
Genome contig ID	gi51511732f_70386946
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAGCTCAGTAGCTGCTAATAAAGTTAAAGATCCTG
Flanking genome sequence (133463 - 133512)	----+--------+--------+--------+--------+----* TGTCCTGCTTTCTCTACTGTTTGGTCAGATGATGAAGTATAAATCTGGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	70486946	70520407	10	99.2	Perfect prediction

Length: 369 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF85729	2.8e-122	99.5	unnamed protein...	Homo sapiens
BAF84077	1.9e-120	99.7	unnamed protein...	Homo sapiens
XP_001105424	2.6e-118	97.8	putative MAPK a...	Macaca mulatta
EDL11428	1.3e-104	94.6	RIKEN cDNA 2400...	Mus musculus
EDL92509	2e-91	93.0	similar to RIKE...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005061	22	144	PF03398	Protein of unknown function DUF292

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TGGATGGATGGGACTCTTATG
Primer_r	GTATCATCCAATCCCAAAGCC
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles