ROUGE

Gene/Protein Characteristic Table for mKIAA0171

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093212
Description :	Epsin 4.
Clone Name :	meh00412 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 6730 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4084 bp

Genome contig ID gi65527427f_45535235
PolyA signal sequence
(ATTAAA,-9)
+----*----+----*----+----*----+----
CTGTTCTATATAACATTAAAACATTCATTAAAACC
Flanking genome sequence
(128228 - 128277)
----+----*----+----*----+----*----+----*----+----*
AACGTGGGCCCGCCTCTTTTCTCATCCACTAGACACGAGGCCATTGGGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0171 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0171	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1219..2646
Length: 475 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001068394	1.6e-144	97.9	similar to Epsi...	Rattus norvegicus
Q99KN9	1.6e-122	94.6	Clathrin intera...	Mus musculus
XP_001068532	1.6e-115	91.4	similar to Epsi...	Rattus norvegicus
CAI25020	2.3e-113	94.2	clathrin intera...	Mus musculus
XP_001068192	3.1e-113	92.3	similar to enth...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173093	6.2e-17	29.1	mKIAA1065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001026 40 164 PF01417 Epsin

HMMSmart IPR001026 41 168 SM00273 Epsin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001026	40	164	PF01417	Epsin
HMMSmart	IPR001026	41	168	SM00273	Epsin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 11 33 LMLIFMYLYVCVCTCTCAFSLCS

Method	From	To	amino acid sequence
SOSUI	11	33	LMLIFMYLYVCVCTCTCAFSLCS

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	4084 bp
Genome contig ID	gi65527427f_45535235
PolyA signal sequence (ATTAAA,-9)	+--------+--------+----*----+---- CTGTTCTATATAACATTAAAACATTCATTAAAACC
Flanking genome sequence (128228 - 128277)	----+--------+--------+--------+--------+----* AACGTGGGCCCGCCTCTTTTCTCATCCACTAGACACGAGGCCATTGGGGG

Gene/Protein Characteristic Table for mKIAA0171

Features of the cloned DNA sequence

Features of the protein sequence