ROUGE |
Gene/Protein Characteristic Table for mKIAA0166 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172905 |
---|---|
Kinetochore-associated protein 1 (Fragment). | |
meg00701 [Vector Info] | |
Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6927 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 184 bp Genome contig ID gi65498774f_122820942 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
GTCTCATATGATGAATCAATAAACTATGTGCACATFlanking genome sequence
(171835 - 171884) ----+----*----+----*----+----*----+----*----+----*
AGCTTTGATGTTGGTTTCTTGTGTCATTTGTAGGGGTTTTGTTTTGAAGT
KIAA Alignment based on: KIAA0166 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..6743
Length: 2246 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |