ROUGE

Gene/Protein Characteristic Table for mKIAA0155

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093211
Description :	SH2 domain binding protein 1 (tetratricopeptide repeat containing). TPR-containing, SH2-binding phosphoprotein.
Clone Name :	mbg02093 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4569 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2647 bp

Genome contig ID gi65511124f_104802405
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCCTCCCCAGTCACTTAATAAACCCTTTACCAACC
Flanking genome sequence
(107109 - 107158)
----+----*----+----*----+----*----+----*----+----*
ATGCGAGTGCCTGTGTGTCCTCTTTTTTTTTTTCTTTTGGCTCAATAACA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0155 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0155	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..333, 1272..1673, 3555..3980
Length: 386 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q62018	4.4e-39	82.3	RNA polymerase-...	Mus musculus
AAC42083	4.4e-39	82.3	phosphoprotein.	Mus musculus
AAI07917	1e-38	80.6	Ctr9 protein [R...	Rattus norvegicus
EDM17845	1.7e-38	80.6	SH2 domain bind...	Rattus norvegicus
XP_238127	1.8e-38	80.6	similar to SH2 ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000637 208 218 PR00929 HMG-I and HMG-Y

IPR000637 229 240 PR00929 HMG-I and HMG-Y

IPR000637 276 286 PR00929 HMG-I and HMG-Y

ProfileScan NULL 265 385 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	208	218	PR00929	HMG-I and HMG-Y
IPR000637	229	240	PR00929	HMG-I and HMG-Y
IPR000637	276	286	PR00929	HMG-I and HMG-Y
ProfileScan	NULL	265	385	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2647 bp
Genome contig ID	gi65511124f_104802405
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCCTCCCCAGTCACTTAATAAACCCTTTACCAACC
Flanking genome sequence (107109 - 107158)	----+--------+--------+--------+--------+----* ATGCGAGTGCCTGTGTGTCCTCTTTTTTTTTTTCTTTTGGCTCAATAACA

Gene/Protein Characteristic Table for mKIAA0155

Features of the cloned DNA sequence

Features of the protein sequence