ROUGE

Gene/Protein Characteristic Table for mKIAA0109

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172889
Description :	Clathrin coat assembly protein AP50.
Clone Name :	msj02122 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2007 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 609 bp

Genome contig ID gi65546577f_19207691
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
GAGTGCTGAGATTAAAGTGTACACCACCATGCCAG
Flanking genome sequence
(108507 - 108556)
----+----*----+----*----+----*----+----*----+----*
ACTTTGTTTTGTTTGGGTCTTGCTGCTTGTAGCTCTGGCTGACCTAGAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0109 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0109	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 88..1398
Length: 436 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH13796	5.8e-188	100.0	Adaptor-related...	Homo sapiens
XP_001363460	1.3e-187	99.8	similar to Adap...	Monodelphis dom...
Q5ZMP6	2.9e-187	99.5	AP-2 complex su...	Gallus gallus
P84092	5.5e-187	99.5	AP-2 complex su...	Rattus norvegicus
CAH93211	6.4e-187	99.3	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001392 15 35 PR00314 Clathrin adaptor complex

IPR001392 101 128 PR00314 Clathrin adaptor complex

IPR001392 162 190 PR00314 Clathrin adaptor complex

IPR001392 244 271 PR00314 Clathrin adaptor complex

IPR001392 313 328 PR00314 Clathrin adaptor complex

IPR001392 353 364 PR00314 Clathrin adaptor complex

HMMPfam IPR001392 160 436 PF00928 Clathrin adaptor complex

ScanRegExp IPR001392 160 180 PS00990 Clathrin adaptor complex

IPR001392 264 278 PS00991 Clathrin adaptor complex

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001392	15	35	PR00314	Clathrin adaptor complex
IPR001392	101	128	PR00314	Clathrin adaptor complex
IPR001392	162	190	PR00314	Clathrin adaptor complex
IPR001392	244	271	PR00314	Clathrin adaptor complex
IPR001392	313	328	PR00314	Clathrin adaptor complex
IPR001392	353	364	PR00314	Clathrin adaptor complex
HMMPfam	IPR001392	160	436	PF00928	Clathrin adaptor complex
ScanRegExp	IPR001392	160	180	PS00990	Clathrin adaptor complex
IPR001392	264	278	PS00991	Clathrin adaptor complex

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	609 bp
Genome contig ID	gi65546577f_19207691
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- GAGTGCTGAGATTAAAGTGTACACCACCATGCCAG
Flanking genome sequence (108507 - 108556)	----+--------+--------+--------+--------+----* ACTTTGTTTTGTTTGGGTCTTGCTGCTTGTAGCTCTGGCTGACCTAGAAA

Gene/Protein Characteristic Table for mKIAA0109

Features of the cloned DNA sequence

Features of the protein sequence