ROUGE

Gene/Protein Characteristic Table for mKIAA0100

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122206
Description :	Gene e1 protein.
Clone Name :	mbg08561 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5069 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 616 bp

Genome contig ID gi65527427f_77897226
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATATTTTAAATTTGAAAAAAAAAAAAAAAAAAAAA
Flanking genome sequence
(137109 - 137158)
----+----*----+----*----+----*----+----*----+----*
GAAAGAAAAGAATAGAGAGAAAGTCATATATACACATACACTTGGCCAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0100 DNA sequence

KIAA	Alignment based on:
KIAA0100	DNA sequence

Features of the protein sequence	Description

Coding region: 2..4453
Length: 1483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC41111	99.9	unnamed protein...	Mus musculus
AAH75633	99.9	RIKEN cDNA 2610...	Mus musculus
XP_001080812	98.7	similar to CG14...	Rattus norvegicus
XP_220636	98.7	similar to CG14...	Rattus norvegicus
XP_001108432	97.3	similar to CG14...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	616 bp
Genome contig ID	gi65527427f_77897226
PolyA signal sequence (None)	+--------+--------+----*----+---- ATATTTTAAATTTGAAAAAAAAAAAAAAAAAAAAA
Flanking genome sequence (137109 - 137158)	----+--------+--------+--------+--------+----* GAAAGAAAAGAATAGAGAGAAAGTCATATATACACATACACTTGGCCAGG

Gene/Protein Characteristic Table for mKIAA0100

Features of the cloned DNA sequence

Features of the protein sequence