KIAA0100

Product ID	ORK00016
Accession No	D43947
Description	KIAA0100
Clone name	ef04121
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7393 bp) Predicted protein sequence (2235 aa)
HaloTag ORF Clone	FHC00016
Flexi ORF Clone	FXC00016
Source
Rouge ID	mKIAA0100 by Kazusa Mouse cDNA Project
Note	We replaced ha00902, former representative clones for KIAA0100 with ef04121. (2005/08/06)

Length: 7393 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	610 bp
Genome contig ID	gi51511734r_23865616
PolyA signal sequence (None)	+--------+--------+----*----+---- GCAAAATGATTTAAAGAGAAAAAAAAAGATATTTT
Flanking genome sequence (99983 - 99934)	----+--------+--------+--------+--------+----* AAATTTGATGCTCATTTTTGTGTGTGTGTGTTGAGTGCATGCATTCAATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	23965599	23996276	39	99.9	Perfect prediction

Length: 2235 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001108491	99.1	similar to CG14...	Macaca mulatta
XP_001108432	99.0	similar to CG14...	Macaca mulatta
BAC41111	94.4	unnamed protein...	Mus musculus
AAH75633	94.4	RIKEN cDNA 2610...	Mus musculus
XP_537745	94.9	similar to CG14...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006231	886	910	PF06039	Malate:quinone-oxidoreductase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	6	SALLVLLLVALSALFLGRWLVVR	28	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GAACAACCTCCTCCCCAATGC
Primer_r	CATCATCTTCCACACTTCGGC
PCR product length	153 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles