ROUGE

Gene/Protein Characteristic Table for mKIAA0092

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129053
Description :	translokin. testis-specific protein 57.
Clone Name :	mpk02578 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 929 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi65519420r_13550497
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GATAAGACTACTTCATGTGTTTCAACCAGCACTAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATAAAAAAAAAGAAGTCAAAACCACCAGAAAAGGTATGAAAACAAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0092 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0092	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..927
Length: 309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL24982	4.9e-92	99.0	centrosomal pro...	Mus musculus
EDL24981	1.7e-81	100.0	centrosomal pro...	Mus musculus
CAX15659	1.5e-74	100.0	centrosomal pro...	Mus musculus
BAC25962	1.6e-74	100.0	unnamed protein...	Mus musculus
AAO73939	1.6e-74	100.0	translokin [Mus...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010597 83 309 PF06657 Protein of unknown function DUF1167

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010597	83	309	PF06657	Protein of unknown function DUF1167

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi65519420r_13550497
PolyA signal sequence (None)	+--------+--------+----*----+---- GATAAGACTACTTCATGTGTTTCAACCAGCACTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATAAAAAAAAAGAAGTCAAAACCACCAGAAAAGGTATGAAAACAAT

Gene/Protein Characteristic Table for mKIAA0092

Features of the cloned DNA sequence

Features of the protein sequence