KIAA0092

Product ID	ORK00013
Accession No	D42054
Description	centrosomal protein 57kDa, transcript variant 3
Clone name	ha01343
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2913 bp) Predicted protein sequence (475 aa)
HaloTag ORF Clone	FHC00013
Flexi ORF Clone	FXC00013
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0092 by Kazusa Mouse cDNA Project

Length: 2913 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1435 bp
Genome contig ID	gi51511727f_95063458
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- AATTTCAGGTCATTAAATTGTATAACCATCATTTG
Flanking genome sequence (142047 - 142096)	----+--------+--------+--------+--------+----* AATTGTAGTGGCTCTGAGTCCTAATTAGGAGAATGGTGATTGAATGATGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	95163458	95205503	10	99.4	Perfect prediction

Length: 475 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11132	2.1e-142	100.0	centrosomal pro...	synthetic construct
EAW66968	1.9e-141	99.6	centrosomal pro...	Homo sapiens
XP_001093445	2.9e-135	96.6	similar to tran...	Macaca mulatta
XP_855815	7.2e-129	90.1	similar to tran...	Canis lupus fam...
EDL24981	5.6e-124	87.6	centrosomal pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010597	32	475	PF06657	Protein of unknown function DUF1167

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TACATAGAAAGAGAGCCCAAG
Primer_r	CAAACAAGGAGATAACAGGAG
PCR product length	293 bp
PCR conditions	95 °C15 sec60 °C60 sec32 cycles