ROUGE

Gene/Protein Characteristic Table for mKIAA0082

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172883
Description :
Clone Name :	mph00974 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3236 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1897 bp

Genome contig ID gi65550231f_27385891
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CAGAATCTTGGATCATTAAACATATTTTTACTGCT
Flanking genome sequence
(127388 - 127437)
----+----*----+----*----+----*----+----*----+----*
CATGTGGCTCTGTGCTGGGCTGCTGTTGTCCACAGTGCTGTGTAACTGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0082 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0082	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 2..1255, 1339..2154
Length: 690 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC33600	5.7e-187	96.0	unnamed protein...	Mus musculus
Q9DBC3	5.7e-187	96.1	FtsJ methyltran...	Mus musculus
BAE31091	7.2e-186	95.7	unnamed protein...	Mus musculus
BAE32821	9.9e-186	96.0	unnamed protein...	Mus musculus
Q5U2Z5	1.6e-185	93.6	FtsJ methyltran...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172991	3.5e-61	100.0	mKIAA0646

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002877 117 336 PF01728 Ribosomal RNA methyltransferase RrmJ/FtsJ

IPR001202 611 641 PF00397 WW/Rsp5/WWP

HMMSmart IPR001202 610 643 SM00456 WW/Rsp5/WWP

ProfileScan IPR001202 609 643 PS50020 WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002877	117	336	PF01728	Ribosomal RNA methyltransferase RrmJ/FtsJ
IPR001202	611	641	PF00397	WW/Rsp5/WWP
HMMSmart	IPR001202	610	643	SM00456	WW/Rsp5/WWP
ProfileScan	IPR001202	609	643	PS50020	WW/Rsp5/WWP

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1897 bp
Genome contig ID	gi65550231f_27385891
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CAGAATCTTGGATCATTAAACATATTTTTACTGCT
Flanking genome sequence (127388 - 127437)	----+--------+--------+--------+--------+----* CATGTGGCTCTGTGCTGGGCTGCTGTTGTCCACAGTGCTGTGTAACTGAG

Gene/Protein Characteristic Table for mKIAA0082

Features of the cloned DNA sequence

Features of the protein sequence