ROUGE

Gene/Protein Characteristic Table for mKIAA0070

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC035324
Description :	Lysyl-tRNA synthetase.
Clone Name :	mpj03164 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2131 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 164 bp

Genome contig ID gi65515060r_111191149
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TATTCCTCGTTACCAAATAAATCATTTCTCTCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCCATGCAGTGTTACTTTTTCTCCCCCGGGCTGCTGGTCTGATGAGTGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0070 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0070	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 69..1967
Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL11526	100.0	mCG141545, isof...	Mus musculus
AAH27356	100.0	Kars protein [M...	Mus musculus
AAH35324	100.0	Kars protein [M...	Mus musculus
AAH83652	96.5	Lysyl-tRNA synt...	Rattus norvegicus
XP_850403	92.2	similar to lysy...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002313 294 304 PR00982 Lysyl-tRNA synthetase

IPR002313 310 326 PR00982 Lysyl-tRNA synthetase

IPR002313 339 352 PR00982 Lysyl-tRNA synthetase

IPR002313 357 374 PR00982 Lysyl-tRNA synthetase

IPR002313 493 509 PR00982 Lysyl-tRNA synthetase

HMMPfam IPR004365 161 241 PF01336 nucleic acid binding

IPR004364 257 610 PF00152 tRNA synthetase

HMMTigr IPR002313 107 612 TIGR00499 Lysyl-tRNA synthetase

ProfileScan IPR006195 279 610 PS50862 Aminoacyl-transfer RNA synthetase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002313	294	304	PR00982	Lysyl-tRNA synthetase
IPR002313	310	326	PR00982	Lysyl-tRNA synthetase
IPR002313	339	352	PR00982	Lysyl-tRNA synthetase
IPR002313	357	374	PR00982	Lysyl-tRNA synthetase
IPR002313	493	509	PR00982	Lysyl-tRNA synthetase
HMMPfam	IPR004365	161	241	PF01336	nucleic acid binding
IPR004364	257	610	PF00152	tRNA synthetase
HMMTigr	IPR002313	107	612	TIGR00499	Lysyl-tRNA synthetase
ProfileScan	IPR006195	279	610	PS50862	Aminoacyl-transfer RNA synthetase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	164 bp
Genome contig ID	gi65515060r_111191149
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TATTCCTCGTTACCAAATAAATCATTTCTCTCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCATGCAGTGTTACTTTTTCTCCCCCGGGCTGCTGGTCTGATGAGTGG

Gene/Protein Characteristic Table for mKIAA0070

Features of the cloned DNA sequence

Features of the protein sequence