ROUGE

Gene/Protein Characteristic Table for mKIAA0068

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220320
Description :	cytoplasmic FMR1 interacting protein 1. selective hybridizing clone.
Clone Name :	mfj64209 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4150 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 309 bp

Genome contig ID gi65511124f_50011708
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CATCCTGTACGAGCATAATACCAACTAATTGTATT
Flanking genome sequence
(188243 - 188292)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAATAAAAAAACAAAAAAAGACCTCTACCAGTTTCTTTTAAATT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0068 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0068	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3841
Length: 1279 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7TMB8	100.0	Cytoplasmic FMR...	Mus musculus
AAH47135	99.9	Cytoplasmic FMR...	Mus musculus
EDL86460	99.8	cytoplasmic FMR...	Rattus norvegicus
BAE27303	99.9	unnamed protein...	Mus musculus
AAC25773	99.6	SHYC [Mus muscu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093288	0	86.9	mKIAA1168

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008081 27 1279 PF05994 Cytoplasmic fragile X mental retardation protein interacting protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008081	27	1279	PF05994	Cytoplasmic fragile X mental retardation protein interacting protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	309 bp
Genome contig ID	gi65511124f_50011708
PolyA signal sequence (None)	+--------+--------+----*----+---- CATCCTGTACGAGCATAATACCAACTAATTGTATT
Flanking genome sequence (188243 - 188292)	----+--------+--------+--------+--------+----* AAAAAAAAATAAAAAAACAAAAAAAGACCTCTACCAGTTTCTTTTAAATT

Gene/Protein Characteristic Table for mKIAA0068

Features of the cloned DNA sequence

Features of the protein sequence