ROUGE

Gene/Protein Characteristic Table for mKIAA0056

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129046
Description :
Clone Name :	mfj00763 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 5021 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 502 bp

Genome contig ID gi65519420f_26824742
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
AGTCTTTCTAAAACAAAGTAATAAATGTCAAATAT
Flanking genome sequence
(164323 - 164372)
----+----*----+----*----+----*----+----*----+----*
AAATATAACCTAGCATTTATTATAATTTTTCTGGCTTTGGAGCAAGGCTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0056 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0056	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..4519
Length: 1505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZQK0	100.0	Condensin-2 com...	Mus musculus
EDL25317	99.9	RIKEN cDNA B130...	Mus musculus
NP_835214	99.9	non-SMC condens...	Mus musculus
BAE23883	99.9	unnamed protein...	Mus musculus
AAH48190	99.3	Non-SMC condens...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129068	0.00087	23.3	mKIAA0159

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 531 566 PF02985 HEAT

IPR000357 573 604 PF02985 HEAT

IPR000357 967 1003 PF02985 HEAT

ProfileScan NULL 1281 1314 PS50310 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	531	566	PF02985	HEAT
IPR000357	573	604	PF02985	HEAT
IPR000357	967	1003	PF02985	HEAT
ProfileScan	NULL	1281	1314	PS50310	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	502 bp
Genome contig ID	gi65519420f_26824742
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- AGTCTTTCTAAAACAAAGTAATAAATGTCAAATAT
Flanking genome sequence (164323 - 164372)	----+--------+--------+--------+--------+----* AAATATAACCTAGCATTTATTATAATTTTTCTGGCTTTGGAGCAAGGCTT

Gene/Protein Characteristic Table for mKIAA0056

Features of the cloned DNA sequence

Features of the protein sequence