ROUGE

Gene/Protein Characteristic Table for mKIAA0052

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129045
Description :
Clone Name :	mpg01121 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4440 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3159 bp

Genome contig ID gi65535943r_109162259
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
GCGTCTTTCAATAAAAATGTACAGGTGGGACAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTTAGTGACAGGCTTCATTTTCTTTAATTGAACTGTTACTCATTGTGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0052 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0052	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1212, 1280..1657, 3625..4269
Length: 744 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC40348	6.2e-166	97.0	unnamed protein...	Mus musculus
Q9CZU3	6.4e-166	97.0	Superkiller vir...	Mus musculus
EDM10360	6.4e-166	96.6	similar to RIKE...	Rattus norvegicus
XP_001145481	5.8e-165	95.8	superkiller vir...	Pan troglodytes
XP_517760	6e-165	95.8	superkiller vir...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173025	1.1e-08	29.7	mKIAA0788

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001650 168 252 PF00271 Helicase

IPR012961 556 744 PF08148 DSH

HMMSmart IPR001650 163 252 SM00490 Helicase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001650	168	252	PF00271	Helicase
IPR012961	556	744	PF08148	DSH
HMMSmart	IPR001650	163	252	SM00490	Helicase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3159 bp
Genome contig ID	gi65535943r_109162259
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GCGTCTTTCAATAAAAATGTACAGGTGGGACAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTTAGTGACAGGCTTCATTTTCTTTAATTGAACTGTTACTCATTGTGTT

Gene/Protein Characteristic Table for mKIAA0052

Features of the cloned DNA sequence

Features of the protein sequence