ROUGE

Gene/Protein Characteristic Table for mKIAA0035

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129040
Description :	nucleolar and coiled-body phosphoprotein 1.
Clone Name :	mpj00603 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2405 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 292 bp

Genome contig ID gi65553144f_45523200
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
GATTTGTATATTTTATATTAAATAATGTAATACAG
Flanking genome sequence
(108431 - 108480)
----+----*----+----*----+----*----+----*----+----*
ATTTTTGTTGTGATTTTCAGAGATGACTTCCACAGATTAAAGTCTTAGCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0035 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0035	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2113
Length: 703 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL41979	2.4e-147	99.4	nucleolar and c...	Mus musculus
NP_001034441	1.2e-146	99.3	nucleolar and c...	Mus musculus
BAE38994	5.4e-146	99.1	unnamed protein...	Mus musculus
BAE27690	7.6e-146	99.0	unnamed protein...	Mus musculus
EDL41977	7.6e-146	99.0	nucleolar and c...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR003993 208 226 PR01503 Treacher Collins syndrome protein Treacle

IPR003993 430 443 PR01503 Treacher Collins syndrome protein Treacle

IPR003993 452 475 PR01503 Treacher Collins syndrome protein Treacle

HMMPfam IPR007718 605 700 PF05022 SRP40

ProfileScan NULL 227 529 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003993	208	226	PR01503	Treacher Collins syndrome protein Treacle
IPR003993	430	443	PR01503	Treacher Collins syndrome protein Treacle
IPR003993	452	475	PR01503	Treacher Collins syndrome protein Treacle
HMMPfam	IPR007718	605	700	PF05022	SRP40
ProfileScan	NULL	227	529	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	292 bp
Genome contig ID	gi65553144f_45523200
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GATTTGTATATTTTATATTAAATAATGTAATACAG
Flanking genome sequence (108431 - 108480)	----+--------+--------+--------+--------+----* ATTTTTGTTGTGATTTTCAGAGATGACTTCCACAGATTAAAGTCTTAGCT

Gene/Protein Characteristic Table for mKIAA0035

Features of the cloned DNA sequence

Features of the protein sequence