ROUGE |
Gene/Protein Characteristic Table for mKIAA0031 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172875 |
---|---|
116 kDa U5 small nuclear ribonucleoprotein component. | |
mfj01557 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3278 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 323 bp Genome contig ID gi65527427r_102559568 PolyA signal sequence
(TATAAA,-22) +----*----+----*----+----*----+----
TTTAGCCACAGTTTATAAATGAACAGGACATTCTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACCTCTGCCTTGGTTTGCTGCTTTCGTTCACCCCCCACCCCGTCTGATCC
KIAA Alignment based on: KIAA0031 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 25..2955
Length: 976 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000795 | 135 | 148 | PR00315 | Protein synthesis factor |
IPR000795 | 180 | 188 | PR00315 | Protein synthesis factor | |
IPR000795 | 205 | 215 | PR00315 | Protein synthesis factor | |
IPR000795 | 221 | 232 | PR00315 | Protein synthesis factor | |
IPR000795 | 257 | 266 | PR00315 | Protein synthesis factor | |
HMMPfam | IPR000795 | 131 | 446 | PF00009 | Protein synthesis factor |
IPR004161 | 493 | 570 | PF03144 | Elongation factor Tu | |
IPR005517 | 709 | 828 | PF03764 | Elongation factor G | |
IPR000640 | 830 | 919 | PF00679 | Elongation factor G | |
HMMTigr | IPR005225 | 131 | 305 | TIGR00231 | Small GTP-binding protein domain |
ProfileScan | NULL | 7 | 55 | PS50312 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |