| ROUGE |
Gene/Protein Characteristic Table for mKIAA0024 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK172873 |
|---|---|
| Phosphatidylserine synthase I. | |
| mth00575 [Vector Info] | |
| Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4810 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3249 bp Genome contig ID gi65535943f_63435288 PolyA signal sequence
(ATTAAA,-12) +----*----+----*----+----*----+----
TTGTTTTAAATATATCAGTTCACATTAAACAGCTCFlanking genome sequence
(165137 - 165186) ----+----*----+----*----+----*----+----*----+----*
ATCAATGATCTGTCTTTGTTAGAATGATGTTTCTTTGTATCTTATTAGTC
KIAA Alignment based on: KIAA0024 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 614..1552, 3362..3886
Length: 487 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |