ROUGE

Gene/Protein Characteristic Table for mKIAA0017

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129035
Description :	splicing factor 3b, subunit 3, 130kDa.
Clone Name :	mpm11108 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4044 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1363 bp

Genome contig ID gi65515060r_110008215
PolyA signal sequence
(TATAAA,-22)
+----*----+----*----+----*----+----
ACCCTCCTGAATATATAAAACTAGTTTTTAAGGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCTGCGTGTGTAGTTTTTGTTGTTTTGTTTTATAGTCTTTTCCTGGGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0017 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0017	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 138..2618, 2681..3595
Length: 1131 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15393	92.0	Splicing factor...	Homo sapiens
Q921M3	92.1	Splicing factor...	Mus musculus
XP_536791	92.0	similar to spli...	Canis lupus fam...
BAE28225	98.9	unnamed protein...	Mus musculus
BAF84457	91.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004871 757 1073 PF03178 CPSF A subunit

ScanRegExp IPR003006 296 302 PS00290 Immunoglobulin/major histocompatibility complex

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004871	757	1073	PF03178	CPSF A subunit
ScanRegExp	IPR003006	296	302	PS00290	Immunoglobulin/major histocompatibility complex

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1363 bp
Genome contig ID	gi65515060r_110008215
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- ACCCTCCTGAATATATAAAACTAGTTTTTAAGGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCTGCGTGTGTAGTTTTTGTTGTTTTGTTTTATAGTCTTTTCCTGGGAG

Gene/Protein Characteristic Table for mKIAA0017

Features of the cloned DNA sequence

Features of the protein sequence