Order Kazusa clone(s) from : ![]() |
Product ID | ORK00365 |
---|---|
Accession No | D87686 |
Description | splicing factor 3b, subunit 3, 130kDa |
Clone name | ha02425 |
Vector information | |
cDNA sequence | DNA sequence (4294 bp) Predicted protein sequence (1253 aa) |
HaloTag ORF Clone |
FHC00365
![]() |
Flexi ORF Clone | FXC00365 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0017
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 484 bp |
---|---|
Genome contig ID | gi51511732f_69015247 |
PolyA signal sequence (AATAGA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (148456 - 148505) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 69115247 | 69163701 | 26 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | |
---|---|
Primer_r | |
PCR conditions | test |
Panel name | Stanford G3 |
---|---|
Primer_f | GGAATCAGGAGTTGTCACCA |
Primer_r | AAACCACAGGAGTCAATCAG |
PCR product length | 124 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |