ROUGE

Gene/Protein Characteristic Table for mKIAA0007

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129031
Description :	Mitotic checkpoint protein BUB3.
Clone Name :	mph00745 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3368 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1370 bp

Genome contig ID gi65550231f_69292854
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CTTTGTAAAGTGAATAAATACTCATCTTTACCCAG
Flanking genome sequence
(142877 - 142926)
----+----*----+----*----+----*----+----*----+----*
CGCGTGTCTCGTGGTGTATATAGAGTGCACAGGTGTGTGTTTGGGCTTAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0007 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0007	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1998
Length: 665 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6ZQL4	0	100.0	WD repeat-conta...	Mus musculus
EDL38392	0	100.0	mCG5393 [Mus mu...	Mus musculus
XP_001005092	0	100.0	WD repeat domai...	Mus musculus
EDM02876	4.5e-216	91.4	rCG61879 [Rattu...	Rattus norvegicus
AAH79913	4.2e-206	100.0	Wrd43 protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 105 142 PF00400 WD-40 repeat

IPR001680 147 182 PF00400 WD-40 repeat

IPR001680 187 237 PF00400 WD-40 repeat

IPR012979 476 562 PF08162 Protein of unknown function NUC189

HMMSmart IPR001680 33 98 SM00320 WD-40 repeat

IPR001680 101 142 SM00320 WD-40 repeat

IPR001680 145 182 SM00320 WD-40 repeat

IPR001680 185 237 SM00320 WD-40 repeat

ProfileScan IPR001680 110 145 PS50082 WD-40 repeat

IPR001680 110 246 PS50294 WD-40 repeat

NULL 586 665 PS50313 NULL

NULL 595 657 PS50312 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	105	142	PF00400	WD-40 repeat
IPR001680	147	182	PF00400	WD-40 repeat
IPR001680	187	237	PF00400	WD-40 repeat
IPR012979	476	562	PF08162	Protein of unknown function NUC189
HMMSmart	IPR001680	33	98	SM00320	WD-40 repeat
IPR001680	101	142	SM00320	WD-40 repeat
IPR001680	145	182	SM00320	WD-40 repeat
IPR001680	185	237	SM00320	WD-40 repeat
ProfileScan	IPR001680	110	145	PS50082	WD-40 repeat
IPR001680	110	246	PS50294	WD-40 repeat
NULL	586	665	PS50313	NULL
NULL	595	657	PS50312	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1370 bp
Genome contig ID	gi65550231f_69292854
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTTTGTAAAGTGAATAAATACTCATCTTTACCCAG
Flanking genome sequence (142877 - 142926)	----+--------+--------+--------+--------+----* CGCGTGTCTCGTGGTGTATATAGAGTGCACAGGTGTGTGTTTGGGCTTAG

Gene/Protein Characteristic Table for mKIAA0007

Features of the cloned DNA sequence

Features of the protein sequence