ROUGE

Gene/Protein Characteristic Table for mKIAA0003

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172868
Description :	Angiopoietin-1 precursor.
Clone Name :	msh01094 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 4073 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2243 bp

Genome contig ID gi65543215r_42235553
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GTTTCTATTTCAATAAAAGCTGTGTCATTTCTATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATGTCTTCATAAGATTACATTATTTCATTTAAATAAAATTGAAAATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0003 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0003	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 265..1830
Length: 521 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O08538	4.3e-189	99.8	Angiopoietin-1;...	Mus musculus
AAH67410	5e-189	99.6	Angiopoietin 1 ...	Mus musculus
BAC40354	8.5e-189	99.6	unnamed protein...	Mus musculus
EDM16324	5e-188	99.0	angiopoietin 1,...	Rattus norvegicus
O35460	1.7e-186	98.2	Angiopoietin-1;...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002181 305 519 PF00147 Fibrinogen

HMMSmart IPR002181 304 519 SM00186 Fibrinogen

ScanRegExp IPR002181 470 482 PS00514 Fibrinogen

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002181	305	519	PF00147	Fibrinogen
HMMSmart	IPR002181	304	519	SM00186	Fibrinogen
ScanRegExp	IPR002181	470	482	PS00514	Fibrinogen

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2243 bp
Genome contig ID	gi65543215r_42235553
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTTTCTATTTCAATAAAAGCTGTGTCATTTCTATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGTCTTCATAAGATTACATTATTTCATTTAAATAAAATTGAAAATA

Gene/Protein Characteristic Table for mKIAA0003

Features of the cloned DNA sequence

Features of the protein sequence