ROUGE |
Gene/Protein Characteristic Table for mFLJ00407 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC021477 |
---|---|
NEDD9 interacting protein with calponin homology and LIM domains. | |
msh04044 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3513 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 140 bp Genome contig ID gi65524842f_41478187 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
GCTTCGTTGTTTACAATAAAAGGATTATGACCATGFlanking genome sequence
(110668 - 110717) ----+----*----+----*----+----*----+----*----+----*
AACAGGGTTTATGCTCTGTGCTGGCAGGAGACGGGAGTGTGCAAAAAAGG
KIAA Alignment based on: FLJ00407 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 128..3373
Length: 1081 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |