ROUGE

Gene/Protein Characteristic Table for mFLJ00387

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220318
Description :	Serine/threonine kinase PINK1, mitochondrial precursor.
Clone Name :	mbj00169 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2318 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 544 bp

Genome contig ID gi65493515r_137094674
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TAAAGATACGAGCATTAAAGACAGTCTCCATGCCG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGATGTGTACACTGGAGCCAAGTGTTCTCCCACCAGAGGAAAATCACG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00387 DNA sequence

KIAA	Alignment based on:
FLJ00387	DNA sequence

Features of the protein sequence	Description

Coding region: 2..1771
Length: 590 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90392	0	100.0	mFLJ00387 prote...	Mus musculus
ABK42521	6e-216	100.0	PINK1 [syntheti...	synthetic construct
AAK28061	3.3e-215	99.7	protein kinase ...	Mus musculus
Q99MQ3	5.2e-214	99.1	Serine/threonin...	Mus musculus
BAB55651	2e-213	99.0	PTEN induced pu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122357	0.00026	30.4	mKIAA0722
AK122411	0.00055	26.4	mKIAA0973
AK173328	0.00056	29.3	mKIAA2002

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 323 511 PD000001 Protein kinase

HMMPfam IPR000719 166 521 PF00069 Protein kinase

HMMSmart IPR002290 166 520 SM00220 Serine/threonine protein kinase

IPR001245 166 516 SM00219 Tyrosine protein kinase

ProfileScan IPR000719 166 520 PS50011 Protein kinase

ScanRegExp IPR000719 172 203 PS00107 Protein kinase

IPR008271 367 379 PS00108 Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	323	511	PD000001	Protein kinase
HMMPfam	IPR000719	166	521	PF00069	Protein kinase
HMMSmart	IPR002290	166	520	SM00220	Serine/threonine protein kinase
IPR001245	166	516	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	166	520	PS50011	Protein kinase
ScanRegExp	IPR000719	172	203	PS00107	Protein kinase
IPR008271	367	379	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	544 bp
Genome contig ID	gi65493515r_137094674
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TAAAGATACGAGCATTAAAGACAGTCTCCATGCCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGATGTGTACACTGGAGCCAAGTGTTCTCCCACCAGAGGAAAATCACG

Gene/Protein Characteristic Table for mFLJ00387

Features of the cloned DNA sequence

Features of the protein sequence