ROUGE

Gene/Protein Characteristic Table for mFLJ00386

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131186
Description :	Positive cofactor 2 glutamine/Q-rich-associated protein.
Clone Name :	mbe05021 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3221 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 906 bp

Genome contig ID gi65546577r_16322190
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CATATGATTCTTATAATAAATTTATTATTCCTGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTGTCAGGAGTTTATTGCATCTACCTTTTTGCGAGTCTGAGCCCATCTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00386 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00386	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 6..2315
Length: 769 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21436	3.3e-171	100.0	mFLJ00386 prote...	Mus musculus
NP_001035773	3e-166	100.0	mediator comple...	Mus musculus
AAH54779	1.1e-165	99.7	Mediator comple...	Mus musculus
XP_849892	1.7e-152	92.3	similar to posi...	Canis lupus fam...
AAK58423	2.5e-149	91.0	PC2-glutamine-r...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220216	5.2e-05	38.3	mKIAA0192
AK129272	0.0004	29.7	mKIAA1048

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 170 445 PS50322 NULL

IPR000694 285 496 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	170	445	PS50322	NULL
IPR000694	285	496	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	906 bp
Genome contig ID	gi65546577r_16322190
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CATATGATTCTTATAATAAATTTATTATTCCTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTGTCAGGAGTTTATTGCATCTACCTTTTTGCGAGTCTGAGCCCATCTT

Gene/Protein Characteristic Table for mFLJ00386

Features of the cloned DNA sequence

Features of the protein sequence