| ROUGE |
Gene/Protein Characteristic Table for mFLJ00383 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220247 |
|---|---|
| Vacuolar ATP synthase subunit S1 precursor. | |
| mid21056 [Vector Info] | |
| Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2149 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 684 bp Genome contig ID gi66880665f_68857762 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTTCCTTCCTAATAAAATAAAGACGTGTTGCCTTGFlanking genome sequence
(107586 - 107635) ----+----*----+----*----+----*----+----*----+----*
TGTTGGGCTTCGTGTCACTCATTTCTGCACTGAACAGTAGATTTTTTTTT
KIAA Alignment based on: FLJ00383 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1465
Length: 487 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |