ROUGE |
Gene/Protein Characteristic Table for mFLJ00367 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC026543 |
---|---|
bridging integrator-3. | |
mni15278 [Vector Info] | |
Source : | Mouse NKT cells |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1460 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 672 bp Genome contig ID gi65540054f_64334594 PolyA signal sequence
(AGTAAA,-16) +----*----+----*----+----*----+----
TATTGGAATTTTATTTTCAAGTAAAGTTTTCCAGTFlanking genome sequence
(119355 - 119404) ----+----*----+----*----+----*----+----*----+----*
AAAACAACAGTGTACTTTAACTGACACCAAGAGGGAGCTGTCACAGCTTT
KIAA Alignment based on: FLJ00367 DNA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..785
Length: 261 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004148 | 19 | 233 | PF03114 | BAR |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |