ROUGE

Gene/Protein Characteristic Table for mFLJ00358

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220316
Description :
Clone Name :	mbg02077 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4714 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 183 bp

Genome contig ID gi65524842r_80615284
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
GGAAAGAGGGAAACTAATTAAAGGATTAAGATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGGTTGCTTGGCTCCTTTGTGGCTCTAGTGCGCCTTCCTAGGGCTGGGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00358 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00358	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2803..3219, 4124..4531
Length: 274 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90391	3e-106	100.0	mFLJ00358 prote...	Mus musculus
XP_868584	1.1e-87	94.7	similar to CG33...	Canis lupus fam...
EDL31530	2.4e-67	78.3	DNA segment, Ch...	Mus musculus
EDL89264	1.1e-66	77.9	uncharacterized...	Rattus norvegicus
CAG01607	8.5e-50	70.1	unnamed protein...	Tetraodon nigro...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 10 83 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	10	83	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	183 bp
Genome contig ID	gi65524842r_80615284
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GGAAAGAGGGAAACTAATTAAAGGATTAAGATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGGTTGCTTGGCTCCTTTGTGGCTCTAGTGCGCCTTCCTAGGGCTGGGA

Gene/Protein Characteristic Table for mFLJ00358

Features of the cloned DNA sequence

Features of the protein sequence